Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2009313..2009456 | Replicon | chromosome |
| Accession | NZ_CP091607 | ||
| Organism | Salmonella enterica strain 1810 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2009351..2009454 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2009313..2009456 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5513_RS09585 | 2005737..2006435 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| L5513_RS09590 | 2006459..2007115 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| L5513_RS09595 | 2007223..2007453 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5513_RS09600 | 2007591..2007965 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| L5513_RS09605 | 2007966..2008841 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| L5513_RS09610 | 2008858..2009211 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 2009313..2009456 | - | 144 | - | - | Antitoxin |
| - | 2009351..2009454 | + | 104 | - | - | Toxin |
| L5513_RS09615 | 2009585..2010235 | - | 651 | Protein_1878 | tyrosine-type recombinase/integrase | - |
| L5513_RS09620 | 2010246..2010551 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| L5513_RS09625 | 2010508..2010711 | + | 204 | Protein_1880 | phage tail protein | - |
| L5513_RS09630 | 2010883..2011038 | + | 156 | Protein_1881 | phage tail protein | - |
| L5513_RS09635 | 2011144..2011476 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| L5513_RS09640 | 2011525..2011634 | + | 110 | Protein_1883 | tail fiber assembly protein | - |
| L5513_RS09645 | 2011725..2011910 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| L5513_RS09650 | 2012162..2012350 | - | 189 | Protein_1885 | tail fiber assembly protein | - |
| L5513_RS09655 | 2012346..2013116 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| L5513_RS09660 | 2013186..2013284 | + | 99 | Protein_1887 | DUF4113 domain-containing protein | - |
| L5513_RS09665 | 2013607..2013735 | + | 129 | Protein_1888 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2003649..2053453 | 49804 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233981 NZ_CP091607:2009351-2009454 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT233981 NZ_CP091607:c2009456-2009313 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG