Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3864959..3865104 | Replicon | chromosome |
Accession | NZ_CP091601 | ||
Organism | Klebsiella pneumoniae strain Nord77_R886 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3864966..3865068 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3864959..3865104 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
L5469_RS20110 | 3860490..3861923 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
L5469_RS20115 | 3862039..3862278 | + | 240 | WP_002911393.1 | YebV family protein | - |
L5469_RS20120 | 3862376..3862567 | + | 192 | WP_002911395.1 | YebW family protein | - |
L5469_RS20125 | 3862564..3863217 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
L5469_RS20130 | 3863374..3864342 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
L5469_RS20135 | 3864447..3864590 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3864959..3865104 | + | 146 | - | - | Antitoxin |
- | 3864966..3865068 | - | 103 | - | - | Toxin |
L5469_RS20140 | 3865227..3865565 | - | 339 | WP_002911404.1 | YebY family protein | - |
L5469_RS20145 | 3865582..3866451 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
L5469_RS20150 | 3866455..3866829 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
L5469_RS20155 | 3866942..3867172 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
L5469_RS20160 | 3867251..3867910 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
L5469_RS20165 | 3867914..3869974 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 3855076..3938158 | 83082 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T233946 NZ_CP091601:c3865068-3864966 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233946 NZ_CP091601:3864959-3865104 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT