Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2104632..2104776 | Replicon | chromosome |
| Accession | NZ_CP091540 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain S46L1 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2104672..2104775 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2104632..2104776 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5Z03_RS10285 | 2101058..2101756 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| L5Z03_RS10290 | 2101780..2102436 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L5Z03_RS10295 | 2102544..2102774 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5Z03_RS10300 | 2102912..2103286 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L5Z03_RS10305 | 2103287..2104162 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L5Z03_RS10310 | 2104179..2104532 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2104632..2104776 | - | 145 | - | - | Antitoxin |
| - | 2104672..2104775 | + | 104 | - | - | Toxin |
| L5Z03_RS10315 | 2104906..2105982 | - | 1077 | WP_001189085.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| L5Z03_RS10320 | 2105948..2106229 | - | 282 | WP_023234152.1 | excisionase | - |
| L5Z03_RS10325 | 2106336..2106524 | - | 189 | WP_052929118.1 | DUF1187 family protein | - |
| - | 2106342..2106518 | + | 177 | NuclAT_0 | - | - |
| - | 2106342..2106518 | + | 177 | NuclAT_0 | - | - |
| - | 2106342..2106518 | + | 177 | NuclAT_0 | - | - |
| - | 2106342..2106518 | + | 177 | NuclAT_0 | - | - |
| L5Z03_RS10330 | 2106517..2106711 | - | 195 | WP_042853000.1 | type I toxin-antitoxin system endodeoxyribonuclease toxin RalR | - |
| L5Z03_RS10335 | 2106768..2107577 | - | 810 | WP_052929117.1 | recombination protein RecT | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2082764..2165138 | 82374 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233575 NZ_CP091540:2104672-2104775 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTTTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 145 bp
>AT233575 NZ_CP091540:c2104776-2104632 [Salmonella enterica subsp. enterica serovar Typhimurium]
TAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
TAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG