Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 200762..200905 | Replicon | chromosome |
Accession | NZ_CP091300 | ||
Organism | Salmonella enterica subsp. enterica serovar Bovismorbificans strain SB699 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 200800..200903 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 200762..200905 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
L1971_RS01730 | 197186..197884 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
L1971_RS01735 | 197908..198564 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
L1971_RS01740 | 198672..198902 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
L1971_RS01745 | 199040..199414 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
L1971_RS01750 | 199415..200290 | + | 876 | WP_000979686.1 | copper homeostasis membrane protein CopD | - |
L1971_RS01755 | 200307..200660 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 200762..200905 | - | 144 | - | - | Antitoxin |
- | 200800..200903 | + | 104 | - | - | Toxin |
L1971_RS01760 | 201033..201956 | - | 924 | Protein_217 | tyrosine-type recombinase/integrase | - |
L1971_RS01765 | 202220..202681 | - | 462 | Protein_218 | DNA breaking-rejoining protein | - |
L1971_RS01770 | 202670..202861 | + | 192 | Protein_219 | glycoside hydrolase family 19 protein | - |
L1971_RS01775 | 202915..203448 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
L1971_RS01780 | 203705..203872 | - | 168 | WP_000789530.1 | lytic enzyme | - |
L1971_RS01785 | 203937..204125 | - | 189 | WP_001576014.1 | hypothetical protein | - |
L1971_RS01790 | 204180..204440 | + | 261 | Protein_223 | DUF1441 family protein | - |
L1971_RS01795 | 204442..204657 | + | 216 | Protein_224 | shikimate transporter | - |
L1971_RS01800 | 204655..204999 | + | 345 | Protein_225 | macro domain-containing protein | - |
L1971_RS01805 | 205009..205479 | + | 471 | Protein_226 | tail fiber assembly protein | - |
L1971_RS01810 | 205576..205776 | - | 201 | WP_001751604.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 195098..205479 | 10381 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233080 NZ_CP091300:200800-200903 [Salmonella enterica subsp. enterica serovar Bovismorbificans]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT233080 NZ_CP091300:c200905-200762 [Salmonella enterica subsp. enterica serovar Bovismorbificans]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG