Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2003136..2003276 | Replicon | chromosome |
Accession | NZ_CP091123 | ||
Organism | Serratia marcescens strain CM2017_569 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2003180..2003276 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2003136..2003276 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
L2D48_RS09530 (L2D48_09530) | 1999403..1999648 | + | 246 | WP_000108283.1 | DUF2274 domain-containing protein | - |
L2D48_RS09535 (L2D48_09535) | 1999944..2000174 | - | 231 | WP_033638067.1 | DNA polymerase III subunit theta | - |
L2D48_RS09540 (L2D48_09540) | 2000515..2001033 | + | 519 | WP_038875847.1 | non-heme ferritin | - |
L2D48_RS09545 (L2D48_09545) | 2001327..2001743 | + | 417 | WP_047727770.1 | CopC domain-containing protein YobA | - |
L2D48_RS09550 (L2D48_09550) | 2001746..2002627 | + | 882 | WP_038875842.1 | copper homeostasis membrane protein CopD | - |
L2D48_RS09555 (L2D48_09555) | 2002697..2003038 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 2003136..2003276 | - | 141 | - | - | Antitoxin |
- | 2003180..2003276 | + | 97 | - | - | Toxin |
L2D48_RS09560 (L2D48_09560) | 2003355..2003549 | - | 195 | WP_230122566.1 | tyrosine-type recombinase/integrase | - |
L2D48_RS09565 (L2D48_09565) | 2003985..2004083 | + | 99 | WP_230122671.1 | DUF1367 family protein | - |
L2D48_RS09570 (L2D48_09570) | 2004331..2005140 | - | 810 | WP_139145117.1 | hypothetical protein | - |
L2D48_RS09575 (L2D48_09575) | 2006373..2006702 | - | 330 | WP_038875697.1 | DUF1493 family protein | - |
L2D48_RS09580 (L2D48_09580) | 2006696..2007154 | - | 459 | WP_048233442.1 | hypothetical protein | - |
L2D48_RS09585 (L2D48_09585) | 2007558..2007872 | - | 315 | WP_181421323.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | - | - | 1939269..2011099 | 71830 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T232790 NZ_CP091123:2003180-2003276 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT232790 NZ_CP091123:c2003276-2003136 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG