Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1979776..1979916 | Replicon | chromosome |
Accession | NZ_CP091122 | ||
Organism | Serratia marcescens strain CM2012_028 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1979820..1979916 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1979776..1979916 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
L2D51_RS09535 (L2D51_09535) | 1975043..1975438 | + | 396 | WP_239441773.1 | RidA family protein | - |
L2D51_RS09540 (L2D51_09540) | 1975595..1976548 | + | 954 | WP_063919601.1 | prolyl aminopeptidase | - |
L2D51_RS09545 (L2D51_09545) | 1976581..1976811 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
L2D51_RS09550 (L2D51_09550) | 1977156..1977674 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
L2D51_RS09555 (L2D51_09555) | 1977967..1978383 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
L2D51_RS09560 (L2D51_09560) | 1978386..1979267 | + | 882 | WP_079451356.1 | copper homeostasis membrane protein CopD | - |
L2D51_RS09565 (L2D51_09565) | 1979337..1979678 | + | 342 | WP_016928154.1 | YebY family protein | - |
- | 1979776..1979916 | - | 141 | - | - | Antitoxin |
- | 1979820..1979916 | + | 97 | - | - | Toxin |
L2D51_RS09570 (L2D51_09570) | 1980169..1980573 | + | 405 | WP_079451355.1 | hypothetical protein | - |
L2D51_RS09575 (L2D51_09575) | 1980570..1980788 | - | 219 | WP_033640661.1 | hypothetical protein | - |
L2D51_RS09580 (L2D51_09580) | 1980863..1981213 | - | 351 | WP_033640660.1 | hypothetical protein | - |
L2D51_RS09585 (L2D51_09585) | 1981462..1981812 | + | 351 | WP_004940949.1 | DUF4377 domain-containing protein | - |
L2D51_RS09590 (L2D51_09590) | 1981996..1983195 | + | 1200 | WP_004940952.1 | trans-2-enoyl-CoA reductase family protein | - |
L2D51_RS09595 (L2D51_09595) | 1983422..1983640 | + | 219 | WP_123867628.1 | hypothetical protein | - |
L2D51_RS09600 (L2D51_09600) | 1983812..1984117 | + | 306 | WP_049300680.1 | hypothetical protein | - |
L2D51_RS09605 (L2D51_09605) | 1984166..1984501 | + | 336 | WP_016928131.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T232769 NZ_CP091122:1979820-1979916 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT232769 NZ_CP091122:c1979916-1979776 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG