Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2917897..2918040 | Replicon | chromosome |
| Accession | NZ_CP090929 | ||
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R21.2429 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2917899..2918002 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2917897..2918040 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L1L24_RS14440 | 2913319..2913588 | + | 270 | WP_077905753.1 | hypothetical protein | - |
| L1L24_RS14445 | 2913754..2913894 | + | 141 | WP_000489598.1 | hypothetical protein | - |
| L1L24_RS14450 | 2914040..2914582 | - | 543 | Protein_2838 | IS256 family transposase | - |
| L1L24_RS14455 | 2914602..2914694 | - | 93 | WP_231923105.1 | hypothetical protein | - |
| L1L24_RS14460 | 2914724..2917144 | - | 2421 | WP_024144813.1 | type III secretion system effector SspH3 | - |
| L1L24_RS14465 | 2917317..2917400 | - | 84 | Protein_2841 | phage tail protein | - |
| L1L24_RS14470 | 2917412..2917759 | + | 348 | Protein_2842 | tyrosine-type recombinase/integrase | - |
| - | 2917897..2918040 | + | 144 | - | - | Antitoxin |
| - | 2917899..2918002 | - | 104 | - | - | Toxin |
| L1L24_RS14475 | 2918142..2918495 | - | 354 | WP_000722368.1 | YebY family protein | - |
| L1L24_RS14480 | 2918512..2919387 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| L1L24_RS14485 | 2919388..2919762 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L1L24_RS14490 | 2919900..2920130 | + | 231 | WP_000856227.1 | DNA polymerase III subunit theta | - |
| L1L24_RS14495 | 2920238..2920894 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| L1L24_RS14500 | 2920918..2921616 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2914040..2914717 | 677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T232147 NZ_CP090929:c2918002-2917899 [Salmonella enterica subsp. enterica serovar Agona]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT232147 NZ_CP090929:2917897-2918040 [Salmonella enterica subsp. enterica serovar Agona]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
