Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2012005..2012150 | Replicon | chromosome |
Accession | NZ_CP090432 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KPN857 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2012041..2012143 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2012005..2012150 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LZ608_RS09865 (LZ608_09865) | 2007135..2009195 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
LZ608_RS09870 (LZ608_09870) | 2009199..2009858 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
LZ608_RS09875 (LZ608_09875) | 2009937..2010167 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LZ608_RS09880 (LZ608_09880) | 2010280..2010654 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LZ608_RS09885 (LZ608_09885) | 2010658..2011527 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
LZ608_RS09890 (LZ608_09890) | 2011544..2011882 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2012005..2012150 | - | 146 | - | - | Antitoxin |
- | 2012041..2012143 | + | 103 | - | - | Toxin |
LZ608_RS09895 (LZ608_09895) | 2012518..2012661 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LZ608_RS09900 (LZ608_09900) | 2012766..2013734 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
LZ608_RS09905 (LZ608_09905) | 2013891..2014544 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
LZ608_RS09910 (LZ608_09910) | 2014541..2014732 | - | 192 | WP_002911395.1 | YebW family protein | - |
LZ608_RS09915 (LZ608_09915) | 2014830..2015069 | - | 240 | WP_002911393.1 | YebV family protein | - |
LZ608_RS09920 (LZ608_09920) | 2015185..2016618 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T230731 NZ_CP090432:2012041-2012143 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT230731 NZ_CP090432:c2012150-2012005 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT