Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1695980..1696125 | Replicon | chromosome |
Accession | NZ_CP090222 | ||
Organism | Klebsiella pneumoniae strain BY11 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1696016..1696118 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1695980..1696125 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LVJ01_RS08385 | 1691110..1693170 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
LVJ01_RS08390 | 1693174..1693833 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
LVJ01_RS08395 | 1693912..1694142 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LVJ01_RS08400 | 1694255..1694629 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LVJ01_RS08405 | 1694633..1695502 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
LVJ01_RS08410 | 1695519..1695857 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1695980..1696125 | - | 146 | - | - | Antitoxin |
- | 1696016..1696118 | + | 103 | - | - | Toxin |
LVJ01_RS08415 | 1696494..1696637 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LVJ01_RS08420 | 1696742..1697710 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
LVJ01_RS08425 | 1697867..1698520 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
LVJ01_RS08430 | 1698517..1698708 | - | 192 | WP_002911395.1 | YebW family protein | - |
LVJ01_RS08435 | 1698806..1699045 | - | 240 | WP_002911393.1 | YebV family protein | - |
LVJ01_RS08440 | 1699161..1700594 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1622925..1709196 | 86271 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T230306 NZ_CP090222:1696016-1696118 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT230306 NZ_CP090222:c1696125-1695980 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT