Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5388397..5388542 | Replicon | chromosome |
Accession | NZ_CP090061 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KP-NE368 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5388433..5388535 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5388397..5388542 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LRM38_RS26700 (LRM38_26675) | 5383527..5385587 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
LRM38_RS26705 (LRM38_26680) | 5385591..5386250 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
LRM38_RS26710 (LRM38_26685) | 5386329..5386559 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LRM38_RS26715 (LRM38_26690) | 5386672..5387046 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LRM38_RS26720 (LRM38_26695) | 5387050..5387919 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
LRM38_RS26725 (LRM38_26700) | 5387936..5388274 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 5388397..5388542 | - | 146 | - | - | Antitoxin |
- | 5388433..5388535 | + | 103 | - | - | Toxin |
LRM38_RS26730 (LRM38_26705) | 5388851..5389831 | + | 981 | WP_000019473.1 | IS5-like element ISKpn26 family transposase | - |
LRM38_RS26735 (LRM38_26710) | 5390110..5390253 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LRM38_RS26740 (LRM38_26715) | 5390358..5391326 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
LRM38_RS26745 (LRM38_26720) | 5391483..5392136 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
LRM38_RS26750 (LRM38_26725) | 5392133..5392324 | - | 192 | WP_002911395.1 | YebW family protein | - |
LRM38_RS26755 (LRM38_26730) | 5392422..5392661 | - | 240 | WP_002911393.1 | YebV family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 5388851..5389831 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T229973 NZ_CP090061:5388433-5388535 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT229973 NZ_CP090061:c5388542-5388397 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT