Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2591613..2591703 | Replicon | chromosome |
Accession | NZ_CP089942 | ||
Organism | Erwinia tracheiphila strain MDCuke |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2591614..2591703 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2591613..2591703 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LU604_RS13690 (LU604_13690) | 2587416..2588102 | - | 687 | WP_020323243.1 | RNA chaperone ProQ | - |
LU604_RS13695 (LU604_13695) | 2588199..2588699 | - | 501 | WP_040465820.1 | GAF domain-containing protein | - |
LU604_RS13700 (LU604_13700) | 2589093..2590403 | + | 1311 | Protein_2721 | MlaD family protein | - |
LU604_RS13705 (LU604_13705) | 2590620..2590915 | + | 296 | Protein_2722 | hypothetical protein | - |
LU604_RS13710 (LU604_13710) | 2590906..2591253 | + | 348 | WP_020323248.1 | DUF1493 family protein | - |
LU604_RS13715 (LU604_13715) | 2591314..2591457 | - | 144 | Protein_2724 | DUF2184 domain-containing protein | - |
LU604_RS13720 (LU604_13720) | 2591419..2591556 | + | 138 | WP_020323249.1 | phage integrase | - |
- | 2591613..2591703 | + | 91 | - | - | Antitoxin |
- | 2591614..2591703 | - | 90 | - | - | Toxin |
LU604_RS13725 (LU604_13725) | 2591802..2592152 | - | 351 | WP_020323251.1 | YebY family protein | - |
LU604_RS13730 (LU604_13730) | 2592207..2593082 | - | 876 | WP_020323252.1 | copper homeostasis membrane protein CopD | - |
LU604_RS13735 (LU604_13735) | 2593084..2593455 | - | 372 | WP_233478517.1 | CopC domain-containing protein YobA | - |
LU604_RS13740 (LU604_13740) | 2593616..2593846 | + | 231 | WP_020323254.1 | DNA polymerase III subunit theta | - |
LU604_RS13745 (LU604_13745) | 2593931..2594692 | + | 762 | WP_233478518.1 | carbon-nitrogen hydrolase family protein | - |
LU604_RS13750 (LU604_13750) | 2594697..2595383 | + | 687 | WP_020323256.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 90 bp
>T229771 NZ_CP089942:c2591703-2591614 [Erwinia tracheiphila]
AAGCCTGCATTAATGCCAACTTTTAGCGCATGGCTCTGAACAGAGCCATTTCCCTGGACTGAAGACAGGAGTTGTCTTCA
GTCTTTTTTT
AAGCCTGCATTAATGCCAACTTTTAGCGCATGGCTCTGAACAGAGCCATTTCCCTGGACTGAAGACAGGAGTTGTCTTCA
GTCTTTTTTT
Antitoxin
Download Length: 91 bp
>AT229771 NZ_CP089942:2591613-2591703 [Erwinia tracheiphila]
TAAAAAAAGACTGAAGACAACTCCTGTCTTCAGTCCAGGGAAATGGCTCTGTTCAGAGCCATGCGCTAAAAGTTGGCATT
AATGCAGGCTT
TAAAAAAAGACTGAAGACAACTCCTGTCTTCAGTCCAGGGAAATGGCTCTGTTCAGAGCCATGCGCTAAAAGTTGGCATT
AATGCAGGCTT