Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2185591..2185681 | Replicon | chromosome |
Accession | NZ_CP089932 | ||
Organism | Erwinia tracheiphila strain BHKY |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2185591..2185680 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2185591..2185681 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LU633_RS11510 (LU633_11510) | 2181911..2182597 | - | 687 | WP_020323256.1 | exodeoxyribonuclease X | - |
LU633_RS11515 (LU633_11515) | 2182602..2183363 | - | 762 | WP_020323255.1 | carbon-nitrogen hydrolase family protein | - |
LU633_RS11520 (LU633_11520) | 2183448..2183678 | - | 231 | WP_020323254.1 | DNA polymerase III subunit theta | - |
LU633_RS11525 (LU633_11525) | 2183845..2184210 | + | 366 | WP_152664275.1 | CopC domain-containing protein YobA | - |
LU633_RS11530 (LU633_11530) | 2184248..2185087 | + | 840 | WP_232426917.1 | copper homeostasis membrane protein CopD | - |
LU633_RS11535 (LU633_11535) | 2185142..2185492 | + | 351 | WP_020323251.1 | YebY family protein | - |
- | 2185591..2185680 | + | 90 | - | - | Toxin |
- | 2185591..2185681 | - | 91 | - | - | Antitoxin |
LU633_RS11540 (LU633_11540) | 2185749..2185886 | - | 138 | WP_020323249.1 | phage integrase | - |
LU633_RS11545 (LU633_11545) | 2185848..2185991 | + | 144 | Protein_2262 | DUF2184 domain-containing protein | - |
LU633_RS11550 (LU633_11550) | 2186052..2186399 | - | 348 | WP_020323248.1 | DUF1493 family protein | - |
LU633_RS11555 (LU633_11555) | 2186390..2186685 | - | 296 | Protein_2264 | hypothetical protein | - |
LU633_RS11560 (LU633_11560) | 2186902..2188210 | - | 1309 | Protein_2265 | MlaD family protein | - |
LU633_RS11565 (LU633_11565) | 2188604..2189104 | + | 501 | WP_040465820.1 | GAF domain-containing protein | - |
LU633_RS11570 (LU633_11570) | 2189201..2189887 | + | 687 | WP_020323243.1 | RNA chaperone ProQ | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 90 bp
>T229713 NZ_CP089932:2185591-2185680 [Erwinia tracheiphila]
AAGCCTGCATTAATGCCAACTTTTAGCGCATGGCTCTGAACAGAGCCATTTCCCTGGACTGAAGACAGGAGTTGTCTTCA
GTCTTTTTTT
AAGCCTGCATTAATGCCAACTTTTAGCGCATGGCTCTGAACAGAGCCATTTCCCTGGACTGAAGACAGGAGTTGTCTTCA
GTCTTTTTTT
Antitoxin
Download Length: 91 bp
>AT229713 NZ_CP089932:c2185681-2185591 [Erwinia tracheiphila]
TAAAAAAAGACTGAAGACAACTCCTGTCTTCAGTCCAGGGAAATGGCTCTGTTCAGAGCCATGCGCTAAAAGTTGGCATT
AATGCAGGCTT
TAAAAAAAGACTGAAGACAACTCCTGTCTTCAGTCCAGGGAAATGGCTCTGTTCAGAGCCATGCGCTAAAAGTTGGCATT
AATGCAGGCTT