Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1838243..1838383 | Replicon | chromosome |
| Accession | NZ_CP089926 | ||
| Organism | Klebsiella pneumoniae strain KP111 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1838279..1838381 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1838243..1838383 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LVQ71_RS08895 | 1833373..1835433 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
| LVQ71_RS08900 | 1835437..1836096 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
| LVQ71_RS08905 | 1836175..1836405 | - | 231 | WP_048254886.1 | DNA polymerase III subunit theta | - |
| LVQ71_RS08910 | 1836518..1836892 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
| LVQ71_RS08915 | 1836896..1837765 | + | 870 | WP_004891049.1 | copper homeostasis membrane protein CopD | - |
| LVQ71_RS08920 | 1837782..1838120 | + | 339 | WP_016529031.1 | YebY family protein | - |
| - | 1838243..1838383 | - | 141 | - | - | Antitoxin |
| - | 1838279..1838381 | + | 103 | - | - | Toxin |
| LVQ71_RS08925 | 1838459..1839544 | - | 1086 | WP_277710220.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| LVQ71_RS08930 | 1839513..1839785 | - | 273 | WP_116961240.1 | excisionase | - |
| LVQ71_RS08935 | 1839902..1840168 | - | 267 | WP_128619778.1 | hypothetical protein | - |
| LVQ71_RS08940 | 1840187..1840444 | - | 258 | WP_116961252.1 | DNA polymerase III subunit theta | - |
| LVQ71_RS08945 | 1840489..1840815 | - | 327 | WP_277710221.1 | DUF2591 family protein | - |
| LVQ71_RS08950 | 1840812..1840979 | - | 168 | WP_277710222.1 | DUF2737 family protein | - |
| LVQ71_RS08955 | 1841324..1841806 | - | 483 | WP_049001950.1 | siphovirus Gp157 family protein | - |
| LVQ71_RS08960 | 1841799..1842692 | - | 894 | WP_277710225.1 | RecT family recombinase | - |
| LVQ71_RS08965 | 1842689..1842997 | - | 309 | WP_253889961.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1833406..1900437 | 67031 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T229634 NZ_CP089926:1838279-1838381 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT229634 NZ_CP089926:c1838383-1838243 [Klebsiella pneumoniae]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
