Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2061439..2061582 | Replicon | chromosome |
| Accession | NZ_CP089797 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain ZTA19/00790 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2061477..2061580 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2061439..2061582 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LUY11_RS10055 | 2057863..2058561 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LUY11_RS10060 | 2058585..2059241 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| LUY11_RS10065 | 2059349..2059579 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LUY11_RS10070 | 2059717..2060091 | + | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| LUY11_RS10075 | 2060092..2060967 | + | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| LUY11_RS10080 | 2060984..2061337 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2061439..2061582 | - | 144 | - | - | Antitoxin |
| - | 2061477..2061580 | + | 104 | - | - | Toxin |
| LUY11_RS10085 | 2061711..2062058 | - | 348 | Protein_1974 | tyrosine-type recombinase/integrase | - |
| LUY11_RS10090 | 2062070..2062153 | + | 84 | Protein_1975 | phage tail protein | - |
| LUY11_RS10095 | 2062327..2064261 | + | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| LUY11_RS10105 | 2064403..2064931 | + | 529 | Protein_1977 | transposase | - |
| LUY11_RS10110 | 2065077..2065217 | - | 141 | WP_031607419.1 | hypothetical protein | - |
| LUY11_RS10115 | 2065383..2065651 | - | 269 | Protein_1979 | hypothetical protein | - |
| LUY11_RS10120 | 2065691..2065891 | + | 201 | WP_023223931.1 | hypothetical protein | - |
| LUY11_RS10125 | 2066020..2066439 | + | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2064593..2064931 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T229416 NZ_CP089797:2061477-2061580 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT229416 NZ_CP089797:c2061582-2061439 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG