Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2824820..2824963 | Replicon | chromosome |
| Accession | NZ_CP089788 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain ZTA19/00847 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2824822..2824925 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2824820..2824963 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LUY19_RS13490 | 2819963..2820382 | - | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
| LUY19_RS13495 | 2820511..2820711 | - | 201 | WP_023223931.1 | hypothetical protein | - |
| LUY19_RS13500 | 2820751..2821019 | + | 269 | Protein_2625 | hypothetical protein | - |
| LUY19_RS13505 | 2821185..2821325 | + | 141 | WP_031607419.1 | hypothetical protein | - |
| LUY19_RS13510 | 2821471..2821999 | - | 529 | Protein_2627 | transposase | - |
| LUY19_RS13515 | 2822019..2822111 | - | 93 | WP_230855586.1 | hypothetical protein | - |
| LUY19_RS13520 | 2822141..2824075 | - | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| LUY19_RS13525 | 2824249..2824332 | - | 84 | Protein_2630 | phage tail protein | - |
| LUY19_RS13530 | 2824344..2824691 | + | 348 | Protein_2631 | tyrosine-type recombinase/integrase | - |
| - | 2824820..2824963 | + | 144 | - | - | Antitoxin |
| - | 2824822..2824925 | - | 104 | - | - | Toxin |
| LUY19_RS13535 | 2825065..2825418 | - | 354 | WP_000722368.1 | YebY family protein | - |
| LUY19_RS13540 | 2825435..2826310 | - | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| LUY19_RS13545 | 2826311..2826685 | - | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| LUY19_RS13550 | 2826823..2827053 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LUY19_RS13555 | 2827161..2827817 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| LUY19_RS13560 | 2827841..2828539 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2821471..2821809 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T229274 NZ_CP089788:c2824925-2824822 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT229274 NZ_CP089788:2824820-2824963 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
