Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1827368..1827517 | Replicon | chromosome |
Accession | NZ_CP089441 | ||
Organism | Klebsiella quasipneumoniae strain GLW9C22 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1827409..1827511 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1827368..1827517 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LT990_RS08840 | 1822503..1824563 | + | 2061 | WP_044523975.1 | oligopeptidase B | - |
LT990_RS08845 | 1824567..1825226 | - | 660 | WP_023290237.1 | exodeoxyribonuclease X | - |
LT990_RS08850 | 1825305..1825535 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LT990_RS08855 | 1825648..1826022 | + | 375 | WP_064154397.1 | CopC domain-containing protein YobA | - |
LT990_RS08860 | 1826026..1826895 | + | 870 | WP_087827148.1 | copper homeostasis membrane protein CopD | - |
LT990_RS08865 | 1826912..1827250 | + | 339 | WP_072413393.1 | YebY family protein | - |
- | 1827368..1827517 | - | 150 | - | - | Antitoxin |
- | 1827409..1827511 | + | 103 | - | - | Toxin |
LT990_RS08870 | 1827644..1827925 | - | 282 | Protein_1724 | tyrosine-type recombinase/integrase | - |
LT990_RS08875 | 1828002..1828481 | + | 480 | WP_087827146.1 | lysis protein | - |
LT990_RS08880 | 1828936..1829131 | + | 196 | Protein_1726 | DNA polymerase V | - |
LT990_RS08885 | 1829270..1830550 | + | 1281 | WP_217220096.1 | hypothetical protein | - |
LT990_RS08890 | 1831024..1831299 | - | 276 | WP_142375639.1 | hypothetical protein | - |
LT990_RS08895 | 1831895..1832038 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1822536..1838755 | 16219 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T228257 NZ_CP089441:1827409-1827511 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 150 bp
>AT228257 NZ_CP089441:c1827517-1827368 [Klebsiella quasipneumoniae]
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG