Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2018031..2018175 | Replicon | chromosome |
Accession | NZ_CP089385 | ||
Organism | Klebsiella variicola subsp. variicola strain KPN692 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2018067..2018169 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2018031..2018175 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LUX40_RS09680 (LUX40_09680) | 2013161..2015221 | + | 2061 | WP_012541258.1 | oligopeptidase B | - |
LUX40_RS09685 (LUX40_09685) | 2015225..2015884 | - | 660 | WP_008804267.1 | exodeoxyribonuclease X | - |
LUX40_RS09690 (LUX40_09690) | 2015963..2016193 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
LUX40_RS09695 (LUX40_09695) | 2016307..2016681 | + | 375 | WP_038421459.1 | CopC domain-containing protein YobA | - |
LUX40_RS09700 (LUX40_09700) | 2016685..2017554 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
LUX40_RS09705 (LUX40_09705) | 2017571..2017909 | + | 339 | WP_004189269.1 | YebY family protein | - |
- | 2018031..2018175 | - | 145 | - | - | Antitoxin |
- | 2018067..2018169 | + | 103 | - | - | Toxin |
LUX40_RS09710 (LUX40_09710) | 2018554..2018697 | - | 144 | WP_046621074.1 | Ecr family regulatory small membrane protein | - |
LUX40_RS09715 (LUX40_09715) | 2018801..2019769 | - | 969 | WP_162493241.1 | VirK/YbjX family protein | - |
LUX40_RS09720 (LUX40_09720) | 2019926..2020579 | + | 654 | WP_008804273.1 | protein-serine/threonine phosphatase | - |
LUX40_RS09725 (LUX40_09725) | 2020576..2020767 | - | 192 | WP_002911395.1 | YebW family protein | - |
LUX40_RS09730 (LUX40_09730) | 2020865..2021104 | - | 240 | WP_002911393.1 | YebV family protein | - |
LUX40_RS09735 (LUX40_09735) | 2021220..2022653 | - | 1434 | WP_232393220.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T228136 NZ_CP089385:2018067-2018169 [Klebsiella variicola subsp. variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT228136 NZ_CP089385:c2018175-2018031 [Klebsiella variicola subsp. variicola]
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT