Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2102663..2102808 | Replicon | chromosome |
| Accession | NZ_CP089313 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain YZ21MCS4 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2102703..2102806 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2102663..2102808 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LT987_RS10260 | 2099089..2099787 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LT987_RS10265 | 2099811..2100467 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| LT987_RS10270 | 2100575..2100805 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LT987_RS10275 | 2100943..2101317 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LT987_RS10280 | 2101318..2102193 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| LT987_RS10285 | 2102210..2102563 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2102663..2102808 | - | 146 | - | - | Antitoxin |
| - | 2102703..2102806 | + | 104 | - | - | Toxin |
| LT987_RS10290 | 2102927..2103577 | - | 651 | Protein_2014 | tyrosine-type recombinase/integrase | - |
| LT987_RS10295 | 2103847..2104053 | + | 207 | Protein_2015 | phage tail protein | - |
| LT987_RS10300 | 2104138..2104380 | + | 243 | Protein_2016 | DUF4376 domain-containing protein | - |
| LT987_RS10305 | 2104486..2104817 | + | 332 | Protein_2017 | DUF1353 domain-containing protein | - |
| LT987_RS10310 | 2104866..2104975 | + | 110 | Protein_2018 | tail fiber assembly protein | - |
| LT987_RS10315 | 2105066..2105251 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| LT987_RS10320 | 2105503..2105691 | - | 189 | Protein_2020 | tail fiber assembly protein | - |
| LT987_RS10325 | 2105687..2106457 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| LT987_RS10330 | 2106520..2106624 | + | 105 | Protein_2022 | DUF4113 domain-containing protein | - |
| LT987_RS10335 | 2106947..2107075 | + | 129 | Protein_2023 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2097003..2132285 | 35282 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T228029 NZ_CP089313:2102703-2102806 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT228029 NZ_CP089313:c2102808-2102663 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
