Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2101559..2101704 | Replicon | chromosome |
| Accession | NZ_CP088901 | ||
| Organism | Salmonella enterica subsp. enterica serovar Muenchen strain 180135033 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2101599..2101702 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2101559..2101704 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LRP35_RS10330 | 2097985..2098683 | - | 699 | WP_021294108.1 | exodeoxyribonuclease X | - |
| LRP35_RS10335 | 2098707..2099363 | - | 657 | WP_021294109.1 | carbon-nitrogen hydrolase family protein | - |
| LRP35_RS10340 | 2099471..2099701 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LRP35_RS10345 | 2099839..2100213 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LRP35_RS10350 | 2100214..2101089 | + | 876 | WP_021294110.1 | copper homeostasis membrane protein CopD | - |
| LRP35_RS10355 | 2101106..2101459 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2101559..2101704 | - | 146 | - | - | Antitoxin |
| - | 2101599..2101702 | + | 104 | - | - | Toxin |
| LRP35_RS10360 | 2101832..2102911 | - | 1080 | WP_020438172.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| LRP35_RS10365 | 2102944..2104094 | - | 1151 | Protein_2031 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| LRP35_RS10370 | 2104083..2104274 | + | 192 | Protein_2032 | glycoside hydrolase family 19 protein | - |
| LRP35_RS10375 | 2104328..2104861 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| LRP35_RS10380 | 2105118..2105285 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| LRP35_RS10385 | 2105350..2105538 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| LRP35_RS10390 | 2105593..2105853 | + | 261 | Protein_2036 | DUF1441 family protein | - |
| LRP35_RS10395 | 2106068..2106430 | + | 363 | Protein_2037 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2095897..2141415 | 45518 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T227100 NZ_CP088901:2101599-2101702 [Salmonella enterica subsp. enterica serovar Muenchen]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT227100 NZ_CP088901:c2101704-2101559 [Salmonella enterica subsp. enterica serovar Muenchen]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG