Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2823576..2823721 | Replicon | chromosome |
| Accession | NZ_CP088229 | ||
| Organism | Enterobacter kobei strain Ek72 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2823583..2823686 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2823576..2823721 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LK774_RS13550 (LK774_13575) | 2818650..2819261 | + | 612 | WP_063308740.1 | hypothetical protein | - |
| LK774_RS13555 (LK774_13580) | 2819258..2819449 | + | 192 | WP_022650956.1 | DUF1382 family protein | - |
| LK774_RS13560 (LK774_13585) | 2819446..2819766 | + | 321 | WP_063308741.1 | hypothetical protein | - |
| LK774_RS13565 (LK774_13590) | 2819858..2820283 | + | 426 | WP_063308742.1 | hypothetical protein | - |
| LK774_RS13570 (LK774_13595) | 2820285..2820503 | + | 219 | WP_213833319.1 | TraR/DksA family transcriptional regulator | - |
| LK774_RS13575 (LK774_13600) | 2820503..2820958 | + | 456 | WP_045346710.1 | hypothetical protein | - |
| LK774_RS13580 (LK774_13605) | 2820921..2821160 | + | 240 | WP_045346711.1 | DUF4222 domain-containing protein | - |
| LK774_RS13585 (LK774_13610) | 2821170..2821481 | + | 312 | WP_045346712.1 | hypothetical protein | - |
| LK774_RS13590 (LK774_13615) | 2821585..2821962 | + | 378 | WP_045281533.1 | hypothetical protein | - |
| LK774_RS13595 (LK774_13620) | 2822179..2822451 | + | 273 | WP_023330710.1 | excisionase | - |
| LK774_RS13600 (LK774_13625) | 2822420..2823505 | + | 1086 | WP_023330711.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2823576..2823721 | + | 146 | - | - | Antitoxin |
| - | 2823583..2823686 | - | 104 | - | - | Toxin |
| LK774_RS13605 (LK774_13630) | 2823825..2824163 | - | 339 | WP_014884299.1 | YebY family protein | - |
| LK774_RS13610 (LK774_13635) | 2824180..2825049 | - | 870 | WP_023330712.1 | copper homeostasis membrane protein CopD | - |
| LK774_RS13615 (LK774_13640) | 2825051..2825422 | - | 372 | WP_023330713.1 | CopC domain-containing protein YobA | - |
| LK774_RS13620 (LK774_13645) | 2825560..2825790 | + | 231 | WP_013096102.1 | DNA polymerase III subunit theta | - |
| LK774_RS13625 (LK774_13650) | 2825901..2826551 | + | 651 | WP_014884302.1 | carbon-nitrogen hydrolase family protein | - |
| LK774_RS13630 (LK774_13655) | 2826576..2827238 | + | 663 | WP_014884303.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2786696..2845271 | 58575 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T226988 NZ_CP088229:c2823686-2823583 [Enterobacter kobei]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT226988 NZ_CP088229:2823576-2823721 [Enterobacter kobei]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT