Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1982520..1982664 | Replicon | chromosome |
Accession | NZ_CP087978 | ||
Organism | Klebsiella variicola subsp. variicola strain ZH07 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1982556..1982658 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1982520..1982664 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LPW14_RS09620 (LPW14_09620) | 1977650..1979710 | + | 2061 | WP_012541258.1 | oligopeptidase B | - |
LPW14_RS09625 (LPW14_09625) | 1979714..1980373 | - | 660 | WP_012541259.1 | exodeoxyribonuclease X | - |
LPW14_RS09630 (LPW14_09630) | 1980452..1980682 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
LPW14_RS09635 (LPW14_09635) | 1980796..1981170 | + | 375 | WP_012541261.1 | CopC domain-containing protein YobA | - |
LPW14_RS09640 (LPW14_09640) | 1981174..1982043 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
LPW14_RS09645 (LPW14_09645) | 1982060..1982398 | + | 339 | WP_008804271.1 | YebY family protein | - |
- | 1982520..1982664 | - | 145 | - | - | Antitoxin |
- | 1982556..1982658 | + | 103 | - | - | Toxin |
LPW14_RS09650 (LPW14_09650) | 1983043..1983186 | - | 144 | WP_048268691.1 | Ecr family regulatory small membrane protein | - |
LPW14_RS09655 (LPW14_09655) | 1983290..1984279 | - | 990 | WP_032691211.1 | VirK/YbjX family protein | - |
LPW14_RS09660 (LPW14_09660) | 1984415..1985068 | + | 654 | WP_022066249.1 | protein-serine/threonine phosphatase | - |
LPW14_RS09665 (LPW14_09665) | 1985065..1985256 | - | 192 | WP_002911395.1 | YebW family protein | - |
LPW14_RS09670 (LPW14_09670) | 1985354..1985593 | - | 240 | WP_002911393.1 | YebV family protein | - |
LPW14_RS09675 (LPW14_09675) | 1985709..1987142 | - | 1434 | WP_008804274.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T226502 NZ_CP087978:1982556-1982658 [Klebsiella variicola subsp. variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT226502 NZ_CP087978:c1982664-1982520 [Klebsiella variicola subsp. variicola]
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT