Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1974269..1974414 | Replicon | chromosome |
Accession | NZ_CP087611 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain DD02172 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1974305..1974407 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1974269..1974414 (-) |
Genomic Context
Location: 1969399..1971459 (2061 bp)
Type: Others
Protein ID: WP_004151449.1
Type: Others
Protein ID: WP_004151449.1
Location: 1972544..1972918 (375 bp)
Type: Others
Protein ID: WP_004151448.1
Type: Others
Protein ID: WP_004151448.1
Location: 1972922..1973791 (870 bp)
Type: Others
Protein ID: WP_004151447.1
Type: Others
Protein ID: WP_004151447.1
Location: 1973808..1974146 (339 bp)
Type: Others
Protein ID: WP_002911404.1
Type: Others
Protein ID: WP_002911404.1
Location: 1974305..1974407 (103 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 1976156..1976809 (654 bp)
Type: Others
Protein ID: WP_004180432.1
Type: Others
Protein ID: WP_004180432.1
Location: 1971463..1972122 (660 bp)
Type: Others
Protein ID: WP_020324964.1
Type: Others
Protein ID: WP_020324964.1
Location: 1972201..1972431 (231 bp)
Type: Others
Protein ID: WP_002911406.1
Type: Others
Protein ID: WP_002911406.1
Location: 1974269..1974414 (146 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 1974783..1974926 (144 bp)
Type: Others
Protein ID: WP_002911398.1
Type: Others
Protein ID: WP_002911398.1
Location: 1975031..1975999 (969 bp)
Type: Others
Protein ID: WP_004151446.1
Type: Others
Protein ID: WP_004151446.1
Location: 1976806..1976997 (192 bp)
Type: Others
Protein ID: WP_002911395.1
Type: Others
Protein ID: WP_002911395.1
Location: 1977095..1977334 (240 bp)
Type: Others
Protein ID: WP_002911393.1
Type: Others
Protein ID: WP_002911393.1
Location: 1977450..1978883 (1434 bp)
Type: Others
Protein ID: WP_004148845.1
Type: Others
Protein ID: WP_004148845.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LMH59_RS09450 | 1969399..1971459 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
LMH59_RS09455 | 1971463..1972122 | - | 660 | WP_020324964.1 | exodeoxyribonuclease X | - |
LMH59_RS09460 | 1972201..1972431 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LMH59_RS09465 | 1972544..1972918 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LMH59_RS09470 | 1972922..1973791 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
LMH59_RS09475 | 1973808..1974146 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1974269..1974414 | - | 146 | - | - | Antitoxin |
- | 1974305..1974407 | + | 103 | - | - | Toxin |
LMH59_RS09480 | 1974783..1974926 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LMH59_RS09485 | 1975031..1975999 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
LMH59_RS09490 | 1976156..1976809 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
LMH59_RS09495 | 1976806..1976997 | - | 192 | WP_002911395.1 | YebW family protein | - |
LMH59_RS09500 | 1977095..1977334 | - | 240 | WP_002911393.1 | YebV family protein | - |
LMH59_RS09505 | 1977450..1978883 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T225655 NZ_CP087611:1974305-1974407 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT225655 NZ_CP087611:c1974414-1974269 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT