Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2923583..2923726 | Replicon | chromosome |
| Accession | NZ_CP086405 | ||
| Organism | Enterobacter roggenkampii strain POL1 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2923588..2923691 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2923583..2923726 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LMJ44_RS13955 (LMJ44_13960) | 2918796..2919623 | + | 828 | WP_084833015.1 | chromosome partitioning protein ParB | - |
| LMJ44_RS13960 (LMJ44_13965) | 2919620..2919907 | + | 288 | WP_131828978.1 | hypothetical protein | - |
| LMJ44_RS13965 (LMJ44_13970) | 2920067..2920348 | + | 282 | WP_084833013.1 | hypothetical protein | - |
| LMJ44_RS13970 (LMJ44_13975) | 2920553..2920909 | + | 357 | WP_229020391.1 | hypothetical protein | - |
| LMJ44_RS13975 (LMJ44_13980) | 2921027..2921314 | + | 288 | WP_074166919.1 | excisionase | - |
| LMJ44_RS13980 (LMJ44_13985) | 2921268..2922125 | + | 858 | WP_229020392.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| LMJ44_RS13985 (LMJ44_13990) | 2922064..2923044 | - | 981 | WP_016947617.1 | IS5-like element ISKpn26 family transposase | - |
| LMJ44_RS13990 (LMJ44_13995) | 2923085..2923330 | - | 246 | WP_165690317.1 | hypothetical protein | - |
| - | 2923583..2923726 | + | 144 | - | - | Antitoxin |
| - | 2923588..2923691 | - | 104 | - | - | Toxin |
| LMJ44_RS13995 (LMJ44_14000) | 2923830..2924168 | - | 339 | WP_008500468.1 | YebY family protein | - |
| LMJ44_RS14000 (LMJ44_14005) | 2924185..2925054 | - | 870 | WP_063417216.1 | copper homeostasis membrane protein CopD | - |
| LMJ44_RS14005 (LMJ44_14010) | 2925056..2925427 | - | 372 | WP_008500466.1 | CopC domain-containing protein YobA | - |
| LMJ44_RS14010 (LMJ44_14015) | 2925565..2925795 | + | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
| LMJ44_RS14015 (LMJ44_14020) | 2925906..2926556 | + | 651 | WP_063417217.1 | carbon-nitrogen hydrolase family protein | - |
| LMJ44_RS14020 (LMJ44_14025) | 2926581..2927243 | + | 663 | WP_008500463.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2853926..2944530 | 90604 | |
| - | flank | IS/Tn | - | - | 2922064..2923044 | 980 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T223183 NZ_CP086405:c2923691-2923588 [Enterobacter roggenkampii]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT223183 NZ_CP086405:2923583-2923726 [Enterobacter roggenkampii]
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
