Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2833817..2833962 | Replicon | chromosome |
Accession | NZ_CP086201 | ||
Organism | Enterobacter roggenkampii strain F1057 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2833824..2833927 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2833817..2833962 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LL005_RS13410 (LL005_13435) | 2830149..2830367 | + | 219 | WP_045618256.1 | hypothetical protein | - |
LL005_RS13415 (LL005_13440) | 2830364..2830975 | + | 612 | WP_233395860.1 | hypothetical protein | - |
LL005_RS13420 (LL005_13445) | 2831067..2831285 | + | 219 | WP_219998951.1 | TraR/DksA family transcriptional regulator | - |
LL005_RS13425 (LL005_13450) | 2831287..2831778 | - | 492 | WP_219998950.1 | hypothetical protein | - |
LL005_RS13430 (LL005_13455) | 2831971..2832254 | + | 284 | Protein_2629 | DUF550 domain-containing protein | - |
LL005_RS13435 (LL005_13460) | 2832420..2832692 | + | 273 | WP_219998949.1 | excisionase | - |
LL005_RS13440 (LL005_13465) | 2832661..2833746 | + | 1086 | WP_219998948.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2833817..2833962 | + | 146 | - | - | Antitoxin |
- | 2833824..2833927 | - | 104 | - | - | Toxin |
LL005_RS13445 (LL005_13470) | 2834066..2834404 | - | 339 | WP_032652385.1 | YebY family protein | - |
LL005_RS13450 (LL005_13475) | 2834421..2835290 | - | 870 | WP_025910076.1 | copper homeostasis membrane protein CopD | - |
LL005_RS13455 (LL005_13480) | 2835292..2835663 | - | 372 | WP_008500466.1 | CopC domain-containing protein YobA | - |
LL005_RS13460 (LL005_13485) | 2835801..2836031 | + | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
LL005_RS13465 (LL005_13490) | 2836142..2836792 | + | 651 | WP_172513570.1 | carbon-nitrogen hydrolase family protein | - |
LL005_RS13470 (LL005_13495) | 2836817..2837479 | + | 663 | WP_008500463.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2768747..2854766 | 86019 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T222730 NZ_CP086201:c2833927-2833824 [Enterobacter roggenkampii]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT222730 NZ_CP086201:2833817-2833962 [Enterobacter roggenkampii]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT