Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1639534..1639679 | Replicon | chromosome |
Accession | NZ_CP085821 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Charizard |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1639574..1639677 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1639534..1639679 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF63_RS07810 | 1635960..1636658 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
LJF63_RS07815 | 1636682..1637338 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF63_RS07820 | 1637446..1637676 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF63_RS07825 | 1637814..1638188 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF63_RS07830 | 1638189..1639064 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF63_RS07835 | 1639081..1639434 | + | 354 | WP_000722370.1 | YebY family protein | - |
- | 1639534..1639679 | - | 146 | - | - | Antitoxin |
- | 1639574..1639677 | + | 104 | - | - | Toxin |
LJF63_RS07840 | 1639817..1640896 | - | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LJF63_RS07845 | 1640871..1641149 | - | 279 | WP_001575998.1 | excisionase | - |
LJF63_RS07850 | 1641563..1643542 | + | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF63_RS07855 | 1643861..1643959 | + | 99 | WP_223151200.1 | hypothetical protein | - |
LJF63_RS07860 | 1644261..1644479 | + | 219 | WP_001524708.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 1633872..1693578 | 59706 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T222011 NZ_CP085821:1639574-1639677 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT222011 NZ_CP085821:c1639679-1639534 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG