Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2457348..2457493 | Replicon | chromosome |
Accession | NZ_CP085817 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Clefable |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2457388..2457491 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2457348..2457493 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF67_RS11680 | 2453774..2454472 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
LJF67_RS11685 | 2454496..2455152 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF67_RS11690 | 2455260..2455490 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF67_RS11695 | 2455628..2456002 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF67_RS11700 | 2456003..2456878 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF67_RS11705 | 2456895..2457248 | + | 354 | WP_000722370.1 | YebY family protein | - |
- | 2457348..2457493 | - | 146 | - | - | Antitoxin |
- | 2457388..2457491 | + | 104 | - | - | Toxin |
LJF67_RS11710 | 2457631..2458710 | - | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LJF67_RS11715 | 2458685..2458963 | - | 279 | WP_001575998.1 | excisionase | - |
LJF67_RS11720 | 2459377..2461356 | + | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF67_RS11725 | 2461675..2461773 | + | 99 | WP_223151200.1 | hypothetical protein | - |
LJF67_RS11730 | 2462075..2462293 | + | 219 | WP_001524708.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 2435478..2511392 | 75914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221917 NZ_CP085817:2457388-2457491 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221917 NZ_CP085817:c2457493-2457348 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG