Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2261274..2261419 | Replicon | chromosome |
Accession | NZ_CP085813 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Minun |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2261276..2261379 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2261274..2261419 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF39_RS11270 | 2256474..2256692 | - | 219 | WP_001524708.1 | hypothetical protein | - |
LJF39_RS11275 | 2256994..2257092 | - | 99 | WP_223151200.1 | hypothetical protein | - |
LJF39_RS11280 | 2257411..2259390 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF39_RS11285 | 2259804..2260082 | + | 279 | WP_001575998.1 | excisionase | - |
LJF39_RS11290 | 2260057..2261136 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2261274..2261419 | + | 146 | - | - | Antitoxin |
- | 2261276..2261379 | - | 104 | - | - | Toxin |
LJF39_RS11295 | 2261519..2261872 | - | 354 | WP_000722370.1 | YebY family protein | - |
LJF39_RS11300 | 2261889..2262764 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF39_RS11305 | 2262765..2263139 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF39_RS11310 | 2263277..2263507 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF39_RS11315 | 2263615..2264271 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF39_RS11320 | 2264295..2264993 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2215030..2267081 | 52051 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221807 NZ_CP085813:c2261379-2261276 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221807 NZ_CP085813:2261274-2261419 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG