Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 4342941..4343084 | Replicon | chromosome |
| Accession | NZ_CP085812 | ||
| Organism | Salmonella enterica subsp. enterica serovar Schwarzengrund strain Articuno | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 4342943..4343046 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 4342941..4343084 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LJF40_RS21170 (LJF40_21170) | 4338011..4338578 | - | 568 | Protein_4120 | phage terminase large subunit family protein | - |
| LJF40_RS21175 (LJF40_21175) | 4338565..4339056 | - | 492 | WP_000348547.1 | DUF1441 family protein | - |
| LJF40_RS21180 (LJF40_21180) | 4339359..4339526 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| LJF40_RS21185 (LJF40_21185) | 4339783..4340315 | - | 533 | Protein_4123 | DUF2514 domain-containing protein | - |
| LJF40_RS21190 (LJF40_21190) | 4340312..4340560 | - | 249 | Protein_4124 | glycoside hydrolase family 19 protein | - |
| LJF40_RS21195 (LJF40_21195) | 4340552..4341700 | + | 1149 | Protein_4125 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| LJF40_RS21200 (LJF40_21200) | 4341733..4342812 | + | 1080 | WP_000087641.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 4342941..4343084 | + | 144 | - | - | Antitoxin |
| - | 4342943..4343046 | - | 104 | - | - | Toxin |
| LJF40_RS21205 (LJF40_21205) | 4343187..4343540 | - | 354 | WP_000722363.1 | YebY family protein | - |
| LJF40_RS21210 (LJF40_21210) | 4343557..4344432 | - | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
| LJF40_RS21215 (LJF40_21215) | 4344433..4344807 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LJF40_RS21220 (LJF40_21220) | 4344945..4345175 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LJF40_RS21225 (LJF40_21225) | 4345283..4345939 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| LJF40_RS21230 (LJF40_21230) | 4345963..4346661 | + | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 4322815..4348749 | 25934 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221794 NZ_CP085812:c4343046-4342943 [Salmonella enterica subsp. enterica serovar Schwarzengrund]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT221794 NZ_CP085812:4342941-4343084 [Salmonella enterica subsp. enterica serovar Schwarzengrund]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
