Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2718282..2718425 | Replicon | chromosome |
| Accession | NZ_CP085811 | ||
| Organism | Salmonella enterica subsp. enterica serovar Schwarzengrund strain Zapdos | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2718284..2718387 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2718282..2718425 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LJF41_RS13555 (LJF41_13555) | 2713352..2713919 | - | 568 | Protein_2633 | phage terminase large subunit family protein | - |
| LJF41_RS13560 (LJF41_13560) | 2713906..2714397 | - | 492 | WP_000348547.1 | DUF1441 family protein | - |
| LJF41_RS13565 (LJF41_13565) | 2714700..2714867 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| LJF41_RS13570 (LJF41_13570) | 2715124..2715656 | - | 533 | Protein_2636 | DUF2514 domain-containing protein | - |
| LJF41_RS13575 (LJF41_13575) | 2715653..2715901 | - | 249 | Protein_2637 | glycoside hydrolase family 19 protein | - |
| LJF41_RS13580 (LJF41_13580) | 2715893..2717041 | + | 1149 | Protein_2638 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| LJF41_RS13585 (LJF41_13585) | 2717074..2718153 | + | 1080 | WP_000087641.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2718282..2718425 | + | 144 | - | - | Antitoxin |
| - | 2718284..2718387 | - | 104 | - | - | Toxin |
| LJF41_RS13590 (LJF41_13590) | 2718528..2718881 | - | 354 | WP_000722363.1 | YebY family protein | - |
| LJF41_RS13595 (LJF41_13595) | 2718898..2719773 | - | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
| LJF41_RS13600 (LJF41_13600) | 2719774..2720148 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LJF41_RS13605 (LJF41_13605) | 2720286..2720516 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LJF41_RS13610 (LJF41_13610) | 2720624..2721280 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| LJF41_RS13615 (LJF41_13615) | 2721304..2722002 | + | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2685231..2724090 | 38859 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221775 NZ_CP085811:c2718387-2718284 [Salmonella enterica subsp. enterica serovar Schwarzengrund]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT221775 NZ_CP085811:2718282-2718425 [Salmonella enterica subsp. enterica serovar Schwarzengrund]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
