Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1663421..1663564 | Replicon | chromosome |
| Accession | NZ_CP085810 | ||
| Organism | Salmonella enterica subsp. enterica serovar Schwarzengrund strain Moltres | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1663423..1663526 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1663421..1663564 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LJF42_RS08455 (LJF42_08455) | 1658491..1659058 | - | 568 | Protein_1650 | phage terminase large subunit family protein | - |
| LJF42_RS08460 (LJF42_08460) | 1659045..1659536 | - | 492 | WP_000348547.1 | DUF1441 family protein | - |
| LJF42_RS08465 (LJF42_08465) | 1659839..1660006 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| LJF42_RS08470 (LJF42_08470) | 1660263..1660795 | - | 533 | Protein_1653 | DUF2514 domain-containing protein | - |
| LJF42_RS08475 (LJF42_08475) | 1660792..1661040 | - | 249 | Protein_1654 | glycoside hydrolase family 19 protein | - |
| LJF42_RS08480 (LJF42_08480) | 1661032..1662180 | + | 1149 | Protein_1655 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| LJF42_RS08485 (LJF42_08485) | 1662213..1663292 | + | 1080 | WP_000087641.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 1663421..1663564 | + | 144 | - | - | Antitoxin |
| - | 1663423..1663526 | - | 104 | - | - | Toxin |
| LJF42_RS08490 (LJF42_08490) | 1663667..1664020 | - | 354 | WP_000722363.1 | YebY family protein | - |
| LJF42_RS08495 (LJF42_08495) | 1664037..1664912 | - | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
| LJF42_RS08500 (LJF42_08500) | 1664913..1665287 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LJF42_RS08505 (LJF42_08505) | 1665425..1665655 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LJF42_RS08510 (LJF42_08510) | 1665763..1666419 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| LJF42_RS08515 (LJF42_08515) | 1666443..1667141 | + | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1640686..1685437 | 44751 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221753 NZ_CP085810:c1663526-1663423 [Salmonella enterica subsp. enterica serovar Schwarzengrund]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT221753 NZ_CP085810:1663421-1663564 [Salmonella enterica subsp. enterica serovar Schwarzengrund]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
