Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1932190..1932333 | Replicon | chromosome |
Accession | NZ_CP085809 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain Raikou |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1932229..1932331 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1932190..1932333 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF43_RS09270 (LJF43_09270) | 1928614..1929312 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
LJF43_RS09275 (LJF43_09275) | 1929336..1929992 | - | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
LJF43_RS09280 (LJF43_09280) | 1930100..1930330 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF43_RS09285 (LJF43_09285) | 1930468..1930842 | + | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
LJF43_RS09290 (LJF43_09290) | 1930843..1931718 | + | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
LJF43_RS09295 (LJF43_09295) | 1931735..1932088 | + | 354 | WP_000722366.1 | YebY family protein | - |
- | 1932190..1932333 | - | 144 | - | - | Antitoxin |
- | 1932229..1932331 | + | 103 | - | - | Toxin |
LJF43_RS09300 (LJF43_09300) | 1932452..1932760 | - | 309 | Protein_1812 | tyrosine-type recombinase/integrase | - |
LJF43_RS09305 (LJF43_09305) | 1932759..1933120 | - | 362 | Protein_1813 | recombinase RecT | - |
LJF43_RS09310 (LJF43_09310) | 1933121..1933231 | + | 111 | Protein_1814 | replication protein | - |
LJF43_RS09315 (LJF43_09315) | 1933244..1933639 | + | 396 | Protein_1815 | DUF977 family protein | - |
LJF43_RS09320 (LJF43_09320) | 1933925..1935055 | - | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1924848..1963521 | 38673 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T221738 NZ_CP085809:1932229-1932331 [Salmonella enterica subsp. enterica serovar Typhimurium]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT221738 NZ_CP085809:c1932333-1932190 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG