Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2309156..2309299 | Replicon | chromosome |
Accession | NZ_CP085808 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain Entei |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2309158..2309260 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2309156..2309299 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF44_RS11645 (LJF44_11650) | 2306434..2307564 | + | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
LJF44_RS11650 (LJF44_11655) | 2307850..2308245 | - | 396 | Protein_2274 | DUF977 family protein | - |
LJF44_RS11655 (LJF44_11660) | 2308258..2308368 | - | 111 | Protein_2275 | replication protein | - |
LJF44_RS11660 (LJF44_11665) | 2308369..2308730 | + | 362 | Protein_2276 | recombinase RecT | - |
LJF44_RS11665 (LJF44_11670) | 2308729..2309037 | + | 309 | Protein_2277 | tyrosine-type recombinase/integrase | - |
- | 2309156..2309299 | + | 144 | - | - | Antitoxin |
- | 2309158..2309260 | - | 103 | - | - | Toxin |
LJF44_RS11670 (LJF44_11675) | 2309401..2309754 | - | 354 | WP_000722366.1 | YebY family protein | - |
LJF44_RS11675 (LJF44_11680) | 2309771..2310646 | - | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
LJF44_RS11680 (LJF44_11685) | 2310647..2311021 | - | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
LJF44_RS11685 (LJF44_11690) | 2311159..2311389 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF44_RS11690 (LJF44_11695) | 2311497..2312153 | + | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
LJF44_RS11695 (LJF44_11700) | 2312177..2312875 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2306434..2315836 | 9402 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T221717 NZ_CP085808:c2309260-2309158 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT221717 NZ_CP085808:2309156-2309299 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG