Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2457107..2457252 | Replicon | chromosome |
Accession | NZ_CP085796 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Froakie |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2457147..2457250 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2457107..2457252 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF57_RS11680 | 2453533..2454231 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
LJF57_RS11685 | 2454255..2454911 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF57_RS11690 | 2455019..2455249 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF57_RS11695 | 2455387..2455761 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF57_RS11700 | 2455762..2456637 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF57_RS11705 | 2456654..2457007 | + | 354 | WP_000722370.1 | YebY family protein | - |
- | 2457107..2457252 | - | 146 | - | - | Antitoxin |
- | 2457147..2457250 | + | 104 | - | - | Toxin |
LJF57_RS11710 | 2457390..2458469 | - | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LJF57_RS11715 | 2458444..2458722 | - | 279 | WP_001575998.1 | excisionase | - |
LJF57_RS11720 | 2459136..2461115 | + | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF57_RS11725 | 2461434..2461532 | + | 99 | WP_223151200.1 | hypothetical protein | - |
LJF57_RS11730 | 2461834..2462052 | + | 219 | WP_001524708.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 2451445..2511151 | 59706 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221421 NZ_CP085796:2457147-2457250 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221421 NZ_CP085796:c2457252-2457107 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG