Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3157421..3157566 | Replicon | chromosome |
Accession | NZ_CP085795 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Frogadier |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3157461..3157564 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3157421..3157566 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF59_RS15045 | 3153847..3154545 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
LJF59_RS15050 | 3154569..3155225 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF59_RS15055 | 3155333..3155563 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF59_RS15060 | 3155701..3156075 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF59_RS15065 | 3156076..3156951 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF59_RS15070 | 3156968..3157321 | + | 354 | WP_000722370.1 | YebY family protein | - |
- | 3157421..3157566 | - | 146 | - | - | Antitoxin |
- | 3157461..3157564 | + | 104 | - | - | Toxin |
LJF59_RS15075 | 3157704..3158783 | - | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LJF59_RS15080 | 3158758..3159036 | - | 279 | WP_001575998.1 | excisionase | - |
LJF59_RS15085 | 3159450..3161429 | + | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF59_RS15090 | 3161748..3161846 | + | 99 | WP_223151200.1 | hypothetical protein | - |
LJF59_RS15095 | 3162148..3162366 | + | 219 | WP_001524708.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 3151759..3211465 | 59706 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221398 NZ_CP085795:3157461-3157564 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221398 NZ_CP085795:c3157566-3157421 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG