Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3598369..3598514 | Replicon | chromosome |
Accession | NZ_CP085792 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Mightyena |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3598409..3598512 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3598369..3598514 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF62_RS17120 | 3594795..3595493 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
LJF62_RS17125 | 3595517..3596173 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF62_RS17130 | 3596281..3596511 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF62_RS17135 | 3596649..3597023 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF62_RS17140 | 3597024..3597899 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF62_RS17145 | 3597916..3598269 | + | 354 | WP_000722370.1 | YebY family protein | - |
- | 3598369..3598514 | - | 146 | - | - | Antitoxin |
- | 3598409..3598512 | + | 104 | - | - | Toxin |
LJF62_RS17150 | 3598652..3599731 | - | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LJF62_RS17155 | 3599706..3599984 | - | 279 | WP_001575998.1 | excisionase | - |
LJF62_RS17160 | 3600398..3602377 | + | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF62_RS17165 | 3602696..3602794 | + | 99 | WP_223151200.1 | hypothetical protein | - |
LJF62_RS17170 | 3603096..3603314 | + | 219 | WP_001524708.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 3591120..3652413 | 61293 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221320 NZ_CP085792:3598409-3598512 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221320 NZ_CP085792:c3598514-3598369 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG