Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1856838..1856983 | Replicon | chromosome |
Accession | NZ_CP084873 | ||
Organism | Klebsiella pneumoniae strain 03-9138-2 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1856874..1856976 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1856838..1856983 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LGL99_RS08965 | 1851968..1854028 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
LGL99_RS08970 | 1854032..1854691 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
LGL99_RS08975 | 1854770..1855000 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LGL99_RS08980 | 1855113..1855487 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LGL99_RS08985 | 1855491..1856360 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
LGL99_RS08990 | 1856377..1856715 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1856838..1856983 | - | 146 | - | - | Antitoxin |
- | 1856874..1856976 | + | 103 | - | - | Toxin |
LGL99_RS08995 | 1857351..1857494 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LGL99_RS09000 | 1857570..1858604 | - | 1035 | Protein_1753 | IS481 family transposase | - |
LGL99_RS09005 | 1858700..1859668 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
LGL99_RS09010 | 1859825..1860478 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
LGL99_RS09015 | 1860475..1860666 | - | 192 | WP_002911395.1 | YebW family protein | - |
LGL99_RS09020 | 1860764..1861003 | - | 240 | WP_002911393.1 | YebV family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1836236..1875480 | 39244 | |
- | flank | IS/Tn | - | - | 1857351..1858604 | 1253 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T219713 NZ_CP084873:1856874-1856976 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT219713 NZ_CP084873:c1856983-1856838 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT