Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3900222..3900366 | Replicon | chromosome |
Accession | NZ_CP084767 | ||
Organism | Klebsiella variicola subsp. tropica strain CDC4241-71 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3900228..3900330 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3900222..3900366 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LGN97_RS18740 (LGN97_18740) | 3895746..3897179 | + | 1434 | WP_136086040.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
LGN97_RS18745 (LGN97_18745) | 3897295..3897534 | + | 240 | WP_002911393.1 | YebV family protein | - |
LGN97_RS18750 (LGN97_18750) | 3897632..3897823 | + | 192 | WP_002911395.1 | YebW family protein | - |
LGN97_RS18755 (LGN97_18755) | 3897820..3898473 | - | 654 | WP_074385463.1 | protein-serine/threonine phosphatase | - |
LGN97_RS18760 (LGN97_18760) | 3898630..3899598 | + | 969 | WP_168432509.1 | VirK/YbjX family protein | - |
LGN97_RS18765 (LGN97_18765) | 3899702..3899845 | + | 144 | WP_168432511.1 | Ecr family regulatory small membrane protein | - |
- | 3900222..3900366 | + | 145 | - | - | Antitoxin |
- | 3900228..3900330 | - | 103 | - | - | Toxin |
LGN97_RS18770 (LGN97_18770) | 3900488..3900826 | - | 339 | WP_008804271.1 | YebY family protein | - |
LGN97_RS18775 (LGN97_18775) | 3900843..3901712 | - | 870 | WP_136086041.1 | copper homeostasis membrane protein CopD | - |
LGN97_RS18780 (LGN97_18780) | 3901716..3902090 | - | 375 | WP_136086042.1 | CopC domain-containing protein YobA | - |
LGN97_RS18785 (LGN97_18785) | 3902204..3902434 | + | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
LGN97_RS18790 (LGN97_18790) | 3902513..3903172 | + | 660 | WP_136086043.1 | exodeoxyribonuclease X | - |
LGN97_RS18795 (LGN97_18795) | 3903176..3905236 | - | 2061 | WP_136086044.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T219333 NZ_CP084767:c3900330-3900228 [Klebsiella variicola subsp. tropica]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT219333 NZ_CP084767:3900222-3900366 [Klebsiella variicola subsp. tropica]
ACAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT