Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2079776..2079924 | Replicon | chromosome |
Accession | NZ_CP084643 | ||
Organism | Yersinia ruckeri strain 17Y0159 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2079782..2079875 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2079776..2079924 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LGL91_RS09425 (LGL91_09450) | 2074835..2075320 | + | 486 | WP_234056512.1 | phage tail protein | - |
LGL91_RS09430 (LGL91_09455) | 2075317..2076483 | + | 1167 | WP_234056513.1 | phage late control D family protein | - |
LGL91_RS09435 (LGL91_09460) | 2076576..2076794 | + | 219 | WP_045844132.1 | DNA-binding transcriptional regulator | - |
LGL91_RS09440 (LGL91_09465) | 2076948..2078168 | - | 1221 | WP_234056514.1 | ISL3 family transposase | - |
LGL91_RS09445 (LGL91_09470) | 2078189..2078539 | - | 351 | WP_234056515.1 | SH3 domain-containing protein | - |
LGL91_RS09450 (LGL91_09475) | 2078655..2079740 | + | 1086 | WP_276573966.1 | tyrosine-type recombinase/integrase | - |
- | 2079776..2079924 | + | 149 | - | - | Antitoxin |
- | 2079782..2079875 | - | 94 | - | - | Toxin |
LGL91_RS09455 (LGL91_09480) | 2080034..2080375 | - | 342 | WP_004721721.1 | YebY family protein | - |
LGL91_RS09460 (LGL91_09485) | 2080470..2081354 | - | 885 | WP_004721723.1 | copper homeostasis membrane protein CopD | - |
LGL91_RS09465 (LGL91_09490) | 2081356..2081742 | - | 387 | WP_038243346.1 | CopC domain-containing protein YobA | - |
LGL91_RS09470 (LGL91_09495) | 2082147..2082662 | - | 516 | WP_004721727.1 | non-heme ferritin | - |
LGL91_RS09475 (LGL91_09500) | 2083065..2083295 | + | 231 | WP_038243344.1 | DNA polymerase III subunit theta | - |
LGL91_RS09480 (LGL91_09505) | 2083418..2084368 | - | 951 | WP_004721733.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2045103..2085897 | 40794 | |
- | flank | IS/Tn | - | - | 2076948..2078168 | 1220 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T218979 NZ_CP084643:c2079875-2079782 [Yersinia ruckeri]
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 149 bp
>AT218979 NZ_CP084643:2079776-2079924 [Yersinia ruckeri]
ACAAATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGT
TGGCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT
ACAAATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGT
TGGCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT