Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1939196..1939339 | Replicon | chromosome |
Accession | NZ_CP084216 | ||
Organism | Salmonella sp. JXY0409-18 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1939234..1939337 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1939196..1939339 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LDB27_RS09205 | 1935619..1936317 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
LDB27_RS09210 | 1936341..1936997 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LDB27_RS09215 | 1937105..1937335 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LDB27_RS09220 | 1937473..1937847 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LDB27_RS09225 | 1937848..1938723 | + | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
LDB27_RS09230 | 1938740..1939093 | + | 354 | WP_225519938.1 | YebY family protein | - |
- | 1939196..1939339 | - | 144 | - | - | Antitoxin |
- | 1939234..1939337 | + | 104 | - | - | Toxin |
LDB27_RS09235 | 1939477..1940556 | - | 1080 | WP_022742740.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LDB27_RS09240 | 1940531..1940809 | - | 279 | WP_001575998.1 | excisionase | - |
LDB27_RS09245 | 1940870..1941298 | - | 429 | WP_057519946.1 | hypothetical protein | - |
LDB27_RS09250 | 1941397..1941582 | - | 186 | WP_000280163.1 | DUF1187 family protein | - |
LDB27_RS09255 | 1941629..1942459 | - | 831 | WP_079813120.1 | recombination protein RecT | - |
LDB27_RS09260 | 1942452..1943903 | - | 1452 | Protein_1806 | PD-(D/E)XK nuclease-like domain-containing protein | - |
LDB27_RS09265 | 1944051..1944299 | + | 249 | Protein_1807 | glycoside hydrolase family 19 protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1933531..1974720 | 41189 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T218308 NZ_CP084216:1939234-1939337 [Salmonella sp. JXY0409-18]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT218308 NZ_CP084216:c1939339-1939196 [Salmonella sp. JXY0409-18]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG