Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2108131..2108276 | Replicon | chromosome |
| Accession | NZ_CP084194 | ||
| Organism | Salmonella sp. A39 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2108171..2108274 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2108131..2108276 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LDO68_RS10310 | 2104557..2105255 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LDO68_RS10315 | 2105279..2105935 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| LDO68_RS10320 | 2106043..2106273 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LDO68_RS10325 | 2106411..2106785 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LDO68_RS10330 | 2106786..2107661 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| LDO68_RS10335 | 2107678..2108031 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2108131..2108276 | - | 146 | - | - | Antitoxin |
| - | 2108171..2108274 | + | 104 | - | - | Toxin |
| LDO68_RS10340 | 2108405..2109328 | - | 924 | Protein_2021 | tyrosine-type recombinase/integrase | - |
| LDO68_RS10345 | 2109592..2110053 | - | 462 | Protein_2022 | DNA breaking-rejoining protein | - |
| LDO68_RS10350 | 2110042..2110233 | + | 192 | Protein_2023 | glycoside hydrolase family 19 protein | - |
| LDO68_RS10355 | 2110287..2110820 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| LDO68_RS10360 | 2111077..2111244 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| LDO68_RS10365 | 2111309..2111497 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| LDO68_RS10370 | 2111552..2111812 | + | 261 | Protein_2027 | DUF1441 family protein | - |
| LDO68_RS10375 | 2112027..2112371 | + | 345 | Protein_2028 | macro domain-containing protein | - |
| LDO68_RS10380 | 2112381..2112851 | + | 471 | Protein_2029 | tail fiber assembly protein | - |
| LDO68_RS10385 | 2112948..2113148 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2102471..2140780 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T218160 NZ_CP084194:2108171-2108274 [Salmonella sp. A39]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT218160 NZ_CP084194:c2108276-2108131 [Salmonella sp. A39]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
