Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2015581..2015726 | Replicon | chromosome |
Accession | NZ_CP084044 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC12_S471M |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2015617..2015719 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2015581..2015726 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KWJ12_RS09845 | 2010711..2012771 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KWJ12_RS09850 | 2012775..2013434 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KWJ12_RS09855 | 2013513..2013743 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KWJ12_RS09860 | 2013856..2014230 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KWJ12_RS09865 | 2014234..2015103 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
KWJ12_RS09870 | 2015120..2015458 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2015581..2015726 | - | 146 | - | - | Antitoxin |
- | 2015617..2015719 | + | 103 | - | - | Toxin |
KWJ12_RS09875 | 2016095..2016238 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KWJ12_RS09880 | 2016343..2017311 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KWJ12_RS09885 | 2017468..2018121 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KWJ12_RS09890 | 2018118..2018309 | - | 192 | WP_002911395.1 | YebW family protein | - |
KWJ12_RS09895 | 2018407..2018646 | - | 240 | WP_002911393.1 | YebV family protein | - |
KWJ12_RS09900 | 2018762..2020195 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1945018..2022953 | 77935 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T218011 NZ_CP084044:2015617-2015719 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT218011 NZ_CP084044:c2015726-2015581 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT