Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2002142..2002285 | Replicon | chromosome |
| Accession | NZ_CP084001 | ||
| Organism | Salmonella sp. A7 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2002180..2002283 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2002142..2002285 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LCS67_RS09695 | 1998567..1999265 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| LCS67_RS09700 | 1999289..1999945 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| LCS67_RS09705 | 2000052..2000282 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| LCS67_RS09710 | 2000420..2000794 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LCS67_RS09715 | 2000795..2001670 | + | 876 | WP_000979696.1 | copper homeostasis membrane protein CopD | - |
| LCS67_RS09720 | 2001687..2002040 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2002142..2002285 | - | 144 | - | - | Antitoxin |
| - | 2002180..2002283 | + | 104 | - | - | Toxin |
| LCS67_RS09725 | 2002423..2003073 | - | 651 | Protein_1897 | tyrosine-type recombinase/integrase | - |
| LCS67_RS09730 | 2003084..2003389 | + | 306 | WP_223617473.1 | hypothetical protein | - |
| LCS67_RS09735 | 2003313..2003963 | + | 651 | Protein_1899 | DUF4376 domain-containing protein | - |
| LCS67_RS09740 | 2003982..2004359 | + | 378 | WP_042842358.1 | DUF1353 domain-containing protein | - |
| LCS67_RS09745 | 2004363..2004473 | + | 111 | Protein_1901 | tail fiber assembly protein | - |
| LCS67_RS09750 | 2004564..2004749 | - | 186 | WP_071585801.1 | PagK family vesicle-borne virulence factor | - |
| LCS67_RS09755 | 2004995..2005171 | - | 177 | Protein_1903 | tail fiber assembly protein | - |
| LCS67_RS09760 | 2005188..2005958 | - | 771 | WP_000758580.1 | transporter substrate-binding domain-containing protein | - |
| LCS67_RS09765 | 2006449..2006577 | + | 129 | Protein_1905 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1998567..2029968 | 31401 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T217911 NZ_CP084001:2002180-2002283 [Salmonella sp. A7]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT217911 NZ_CP084001:c2002285-2002142 [Salmonella sp. A7]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
