Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2991707..2991852 | Replicon | chromosome |
Accession | NZ_CP083862 | ||
Organism | Enterobacter kobei strain 11743-yvys |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2991714..2991817 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2991707..2991852 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LCD49_RS14460 (LCD49_14485) | 2987088..2987306 | + | 219 | WP_032680689.1 | hypothetical protein | - |
LCD49_RS14465 (LCD49_14490) | 2987303..2987914 | + | 612 | WP_219977112.1 | hypothetical protein | - |
LCD49_RS14470 (LCD49_14495) | 2988003..2988272 | + | 270 | WP_047359562.1 | hypothetical protein | - |
LCD49_RS14475 (LCD49_14500) | 2988275..2988493 | + | 219 | WP_219977110.1 | TraR/DksA family transcriptional regulator | - |
LCD49_RS14480 (LCD49_14505) | 2988493..2988912 | + | 420 | WP_126805191.1 | DUF2591 family protein | - |
LCD49_RS14485 (LCD49_14510) | 2988875..2989105 | + | 231 | Protein_2846 | DUF4222 domain-containing protein | - |
LCD49_RS14490 (LCD49_14515) | 2989107..2989448 | + | 342 | WP_112015858.1 | hypothetical protein | - |
LCD49_RS14495 (LCD49_14520) | 2989489..2989680 | + | 192 | WP_219977109.1 | hypothetical protein | - |
LCD49_RS14500 (LCD49_14525) | 2989725..2990009 | + | 285 | Protein_2849 | DUF550 domain-containing protein | - |
LCD49_RS14505 (LCD49_14530) | 2990310..2990582 | + | 273 | WP_023330710.1 | excisionase | - |
LCD49_RS14510 (LCD49_14535) | 2990551..2991636 | + | 1086 | WP_219977107.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2991707..2991852 | + | 146 | - | - | Antitoxin |
- | 2991714..2991817 | - | 104 | - | - | Toxin |
LCD49_RS14515 (LCD49_14540) | 2991957..2992295 | - | 339 | WP_014884299.1 | YebY family protein | - |
LCD49_RS14520 (LCD49_14545) | 2992312..2993181 | - | 870 | WP_023330712.1 | copper homeostasis membrane protein CopD | - |
LCD49_RS14525 (LCD49_14550) | 2993183..2993554 | - | 372 | WP_219977106.1 | CopC domain-containing protein YobA | - |
LCD49_RS14530 (LCD49_14555) | 2993692..2993922 | + | 231 | WP_013096102.1 | DNA polymerase III subunit theta | - |
LCD49_RS14535 (LCD49_14560) | 2994033..2994683 | + | 651 | WP_045281180.1 | carbon-nitrogen hydrolase family protein | - |
LCD49_RS14540 (LCD49_14565) | 2994708..2995370 | + | 663 | WP_045281179.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2924670..2998163 | 73493 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T217586 NZ_CP083862:c2991817-2991714 [Enterobacter kobei]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT217586 NZ_CP083862:2991707-2991852 [Enterobacter kobei]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT