Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2778293..2778438 | Replicon | chromosome |
Accession | NZ_CP083819 | ||
Organism | Enterobacter roggenkampii strain 13840-yvys |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2778300..2778403 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2778293..2778438 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LCD41_RS13455 (LCD41_13480) | 2773509..2774564 | + | 1056 | WP_247169807.1 | DNA cytosine methyltransferase | - |
LCD41_RS13460 (LCD41_13485) | 2774561..2774779 | + | 219 | Protein_2637 | hypothetical protein | - |
LCD41_RS13465 (LCD41_13490) | 2774776..2775072 | + | 297 | WP_042889503.1 | DUF4406 domain-containing protein | - |
LCD41_RS13470 (LCD41_13495) | 2775069..2775260 | + | 192 | WP_063136989.1 | DUF1382 family protein | - |
LCD41_RS13475 (LCD41_13500) | 2775352..2775573 | + | 222 | WP_058686198.1 | TraR/DksA family transcriptional regulator | - |
LCD41_RS13480 (LCD41_13505) | 2775585..2776280 | + | 696 | WP_234115282.1 | hypothetical protein | - |
LCD41_RS13485 (LCD41_13510) | 2776258..2776497 | + | 240 | WP_045328639.1 | DUF4222 domain-containing protein | - |
LCD41_RS13490 (LCD41_13515) | 2776506..2776736 | + | 231 | WP_247169808.1 | hypothetical protein | - |
LCD41_RS13495 (LCD41_13520) | 2776896..2777168 | + | 273 | WP_103142239.1 | excisionase | - |
LCD41_RS13500 (LCD41_13525) | 2777137..2778222 | + | 1086 | WP_103142238.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2778293..2778438 | + | 146 | - | - | Antitoxin |
- | 2778300..2778403 | - | 104 | - | - | Toxin |
LCD41_RS13505 (LCD41_13530) | 2778542..2778880 | - | 339 | WP_008500468.1 | YebY family protein | - |
LCD41_RS13510 (LCD41_13535) | 2778897..2779766 | - | 870 | WP_047747388.1 | copper homeostasis membrane protein CopD | - |
LCD41_RS13515 (LCD41_13540) | 2779768..2780139 | - | 372 | WP_047747387.1 | CopC domain-containing protein YobA | - |
LCD41_RS13520 (LCD41_13545) | 2780277..2780507 | + | 231 | WP_047747386.1 | DNA polymerase III subunit theta | - |
LCD41_RS13525 (LCD41_13550) | 2780618..2781268 | + | 651 | WP_032675034.1 | carbon-nitrogen hydrolase family protein | - |
LCD41_RS13530 (LCD41_13555) | 2781293..2781955 | + | 663 | WP_008500463.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2709624..2784748 | 75124 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T217431 NZ_CP083819:c2778403-2778300 [Enterobacter roggenkampii]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT217431 NZ_CP083819:2778293-2778438 [Enterobacter roggenkampii]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT