Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1911187..1911332 | Replicon | chromosome |
Accession | NZ_CP083796 | ||
Organism | Klebsiella pneumoniae strain INF019 isolate INF019 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1911223..1911325 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1911187..1911332 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LB481_RS09240 | 1906317..1908377 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
LB481_RS09245 | 1908381..1909040 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
LB481_RS09250 | 1909119..1909349 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LB481_RS09255 | 1909462..1909836 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LB481_RS09260 | 1909840..1910709 | + | 870 | WP_009307538.1 | copper homeostasis membrane protein CopD | - |
LB481_RS09265 | 1910726..1911064 | + | 339 | WP_009307539.1 | YebY family protein | - |
- | 1911187..1911332 | - | 146 | - | - | Antitoxin |
- | 1911223..1911325 | + | 103 | - | - | Toxin |
LB481_RS09270 | 1911701..1911844 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LB481_RS09275 | 1911952..1912917 | - | 966 | Protein_1805 | VirK/YbjX family protein | - |
LB481_RS09280 | 1913074..1913727 | + | 654 | WP_009307541.1 | protein-serine/threonine phosphatase | - |
LB481_RS09285 | 1913724..1913915 | - | 192 | WP_002911395.1 | YebW family protein | - |
LB481_RS09290 | 1914013..1914252 | - | 240 | WP_002911393.1 | YebV family protein | - |
LB481_RS09295 | 1914368..1915801 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T217359 NZ_CP083796:1911223-1911325 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT217359 NZ_CP083796:c1911332-1911187 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT