Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2014568..2014713 | Replicon | chromosome |
Accession | NZ_CP083775 | ||
Organism | Klebsiella pneumoniae strain INF118 isolate INF118 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2014604..2014706 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2014568..2014713 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LB478_RS10130 (LB478_10130) | 2009698..2011758 | + | 2061 | WP_048978170.1 | oligopeptidase B | - |
LB478_RS10135 (LB478_10135) | 2011762..2012421 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
LB478_RS10140 (LB478_10140) | 2012500..2012730 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
LB478_RS10145 (LB478_10145) | 2012843..2013217 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
LB478_RS10150 (LB478_10150) | 2013221..2014090 | + | 870 | WP_163600018.1 | copper homeostasis membrane protein CopD | - |
LB478_RS10155 (LB478_10155) | 2014107..2014445 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2014568..2014713 | - | 146 | - | - | Antitoxin |
- | 2014604..2014706 | + | 103 | - | - | Toxin |
LB478_RS10160 (LB478_10160) | 2015081..2015224 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
LB478_RS10165 (LB478_10165) | 2015329..2016297 | - | 969 | WP_199906775.1 | VirK/YbjX family protein | - |
LB478_RS10170 (LB478_10170) | 2016454..2017107 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
LB478_RS10175 (LB478_10175) | 2017104..2017295 | - | 192 | WP_002911395.1 | YebW family protein | - |
LB478_RS10180 (LB478_10180) | 2017393..2017632 | - | 240 | WP_002911393.1 | YebV family protein | - |
LB478_RS10185 (LB478_10185) | 2017748..2019181 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T217295 NZ_CP083775:2014604-2014706 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT217295 NZ_CP083775:c2014713-2014568 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT