Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3046099..3046300 | Replicon | chromosome |
Accession | NZ_CP083613 | ||
Organism | Enterobacter hormaechei subsp. oharae strain FDAARGOS_1533 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3046104..3046207 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3046099..3046300 (+) |
Genomic Context
Location: 3042359..3043807 (1449 bp)
Type: Others
Protein ID: WP_196362492.1
Type: Others
Protein ID: WP_196362492.1
Location: 3043914..3044153 (240 bp)
Type: Others
Protein ID: WP_006811010.1
Type: Others
Protein ID: WP_006811010.1
Location: 3045000..3045980 (981 bp)
Type: Others
Protein ID: WP_047051764.1
Type: Others
Protein ID: WP_047051764.1
Location: 3046026..3046223 (198 bp)
Type: Others
Protein ID: WP_032609507.1
Type: Others
Protein ID: WP_032609507.1
Location: 3046099..3046300 (202 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 3048083..3048313 (231 bp)
Type: Others
Protein ID: WP_003859784.1
Type: Others
Protein ID: WP_003859784.1
Location: 3048425..3049075 (651 bp)
Type: Others
Protein ID: WP_048982489.1
Type: Others
Protein ID: WP_048982489.1
Location: 3049100..3049762 (663 bp)
Type: Others
Protein ID: WP_047051600.1
Type: Others
Protein ID: WP_047051600.1
Location: 3044188..3044832 (645 bp)
Type: Others
Protein ID: WP_047051763.1
Type: Others
Protein ID: WP_047051763.1
Location: 3046104..3046207 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 3046348..3046686 (339 bp)
Type: Others
Protein ID: WP_003859787.1
Type: Others
Protein ID: WP_003859787.1
Location: 3046703..3047572 (870 bp)
Type: Others
Protein ID: WP_048982486.1
Type: Others
Protein ID: WP_048982486.1
Location: 3047574..3047945 (372 bp)
Type: Others
Protein ID: WP_047051768.1
Type: Others
Protein ID: WP_047051768.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LA353_RS14660 (LA353_14655) | 3042359..3043807 | + | 1449 | WP_196362492.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
LA353_RS14665 (LA353_14660) | 3043914..3044153 | + | 240 | WP_006811010.1 | YebV family protein | - |
LA353_RS14670 (LA353_14665) | 3044188..3044832 | - | 645 | WP_047051763.1 | protein-serine/threonine phosphatase | - |
LA353_RS14675 (LA353_14670) | 3045000..3045980 | + | 981 | WP_047051764.1 | VirK/YbjX family protein | - |
LA353_RS14680 (LA353_14675) | 3046026..3046223 | + | 198 | WP_032609507.1 | hypothetical protein | - |
- | 3046099..3046300 | + | 202 | - | - | Antitoxin |
- | 3046104..3046207 | - | 104 | - | - | Toxin |
LA353_RS14685 (LA353_14680) | 3046348..3046686 | - | 339 | WP_003859787.1 | YebY family protein | - |
LA353_RS14690 (LA353_14685) | 3046703..3047572 | - | 870 | WP_048982486.1 | copper homeostasis membrane protein CopD | - |
LA353_RS14695 (LA353_14690) | 3047574..3047945 | - | 372 | WP_047051768.1 | CopC domain-containing protein YobA | - |
LA353_RS14700 (LA353_14695) | 3048083..3048313 | + | 231 | WP_003859784.1 | DNA polymerase III subunit theta | - |
LA353_RS14705 (LA353_14700) | 3048425..3049075 | + | 651 | WP_048982489.1 | carbon-nitrogen hydrolase family protein | - |
LA353_RS14710 (LA353_14705) | 3049100..3049762 | + | 663 | WP_047051600.1 | exodeoxyribonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T216867 NZ_CP083613:c3046207-3046104 [Enterobacter hormaechei subsp. oharae]
GGCAGGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 202 bp
>AT216867 NZ_CP083613:3046099-3046300 [Enterobacter hormaechei subsp. oharae]
CAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTCAATCGCCCTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGTCCACAGCAAAAGTGGT
CTGAAAAAAAGCGTCAGAACATCACTAAATGTGAAAAACCGC
CAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTCAATCGCCCTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGTCCACAGCAAAAGTGGT
CTGAAAAAAAGCGTCAGAACATCACTAAATGTGAAAAACCGC