Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1970757..1970902 | Replicon | chromosome |
Accession | NZ_CP083055 | ||
Organism | Klebsiella pneumoniae strain 1613258639 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1970793..1970895 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1970757..1970902 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
K9F40_RS09555 | 1965887..1967947 | + | 2061 | WP_105446489.1 | oligopeptidase B | - |
K9F40_RS09560 | 1967951..1968610 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
K9F40_RS09565 | 1968689..1968919 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
K9F40_RS09570 | 1969032..1969406 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
K9F40_RS09575 | 1969410..1970279 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
K9F40_RS09580 | 1970296..1970634 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1970757..1970902 | - | 146 | - | - | Antitoxin |
- | 1970793..1970895 | + | 103 | - | - | Toxin |
K9F40_RS09585 | 1971271..1971414 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
K9F40_RS09590 | 1971519..1972487 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
K9F40_RS09595 | 1972644..1973297 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
K9F40_RS09600 | 1973294..1973485 | - | 192 | WP_002911395.1 | YebW family protein | - |
K9F40_RS09605 | 1973583..1973822 | - | 240 | WP_002911393.1 | YebV family protein | - |
K9F40_RS09610 | 1973938..1975371 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1900194..1975326 | 75132 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T216050 NZ_CP083055:1970793-1970895 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT216050 NZ_CP083055:c1970902-1970757 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT