Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1956265..1956410 | Replicon | chromosome |
| Accession | NZ_CP082338 | ||
| Organism | Salmonella enterica subsp. enterica strain IBG7b4 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1956305..1956408 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1956265..1956410 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K7H10_RS09255 | 1952691..1953389 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K7H10_RS09260 | 1953413..1954069 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| K7H10_RS09265 | 1954177..1954407 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K7H10_RS09270 | 1954545..1954919 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K7H10_RS09275 | 1954920..1955795 | + | 876 | WP_000979706.1 | copper homeostasis membrane protein CopD | - |
| K7H10_RS09280 | 1955812..1956165 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1956265..1956410 | - | 146 | - | - | Antitoxin |
| - | 1956305..1956408 | + | 104 | - | - | Toxin |
| K7H10_RS09285 | 1956538..1957617 | - | 1080 | WP_020438172.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| K7H10_RS09290 | 1957650..1958800 | - | 1151 | Protein_1815 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| K7H10_RS09295 | 1958789..1958980 | + | 192 | Protein_1816 | glycoside hydrolase family 19 protein | - |
| K7H10_RS09300 | 1959034..1959568 | + | 535 | Protein_1817 | DUF2514 domain-containing protein | - |
| K7H10_RS09305 | 1959825..1959992 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K7H10_RS09310 | 1960057..1960245 | - | 189 | WP_001576014.1 | hypothetical protein | - |
| K7H10_RS09315 | 1960300..1960560 | + | 261 | Protein_1820 | DUF1441 family protein | - |
| K7H10_RS23725 | 1960562..1960777 | + | 216 | Protein_1821 | shikimate transporter | - |
| K7H10_RS09320 | 1960775..1961137 | + | 363 | Protein_1822 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1936265..1960563 | 24298 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T214590 NZ_CP082338:1956305-1956408 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT214590 NZ_CP082338:c1956410-1956265 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
