Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2024411..2024556 | Replicon | chromosome |
Accession | NZ_CP080584 | ||
Organism | Klebsiella pneumoniae strain C1398 mutant C1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2024447..2024549 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2024411..2024556 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
K2X23_RS09890 (K2X23_09890) | 2019541..2021601 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
K2X23_RS09895 (K2X23_09895) | 2021605..2022264 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
K2X23_RS09900 (K2X23_09900) | 2022343..2022573 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
K2X23_RS09905 (K2X23_09905) | 2022686..2023060 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
K2X23_RS09910 (K2X23_09910) | 2023064..2023933 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
K2X23_RS09915 (K2X23_09915) | 2023950..2024288 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2024411..2024556 | - | 146 | - | - | Antitoxin |
- | 2024447..2024549 | + | 103 | - | - | Toxin |
K2X23_RS09920 (K2X23_09920) | 2024924..2025067 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
K2X23_RS09925 (K2X23_09925) | 2025172..2026140 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
K2X23_RS09930 (K2X23_09930) | 2026297..2026950 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
K2X23_RS09935 (K2X23_09935) | 2026947..2027138 | - | 192 | WP_002911395.1 | YebW family protein | - |
K2X23_RS09940 (K2X23_09940) | 2027236..2027475 | - | 240 | WP_002911393.1 | YebV family protein | - |
K2X23_RS09945 (K2X23_09945) | 2027591..2029024 | - | 1434 | WP_101345779.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T212199 NZ_CP080584:2024447-2024549 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT212199 NZ_CP080584:c2024556-2024411 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT